View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_low_33 (Length: 255)
Name: NF9096_low_33
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 66 - 248
Target Start/End: Complemental strand, 47495794 - 47495611
Alignment:
| Q |
66 |
gatttgatcaagatggaatcatattgttcaactacttagaaaatttcaagtggttt-cattgctagctagctctctaattgactatctaccaaaaaggga |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47495794 |
gatttgatcaagatggaatcatattgttcaactacatagaaaatttcaagtggttttcattgctagctagctctctaattgactatctaccaaaaaggga |
47495695 |
T |
 |
| Q |
165 |
agaaaaaggcatttcaacattaaacaattattttccattgtatggtcccattatgtacctacctaatcacaattattaacacca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47495694 |
agaaaaaggcatttcaacattaaacaattattttccattgtatggtcccattatgtacctacctaatcacaattattaacacca |
47495611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University