View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_low_41 (Length: 240)
Name: NF9096_low_41
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 24038417 - 24038626
Alignment:
| Q |
18 |
acatcatcttctagagtacattttaaactatgaggaacaacatcaaacacaatacaattaaaatgtaaggaagagtgtctgagatttgctaatagatcag |
117 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
24038417 |
acatcatcttctagagtacgtttaaaactatgaggaaaaacatcaaacacaatacaattaaaatgtaaggaagagtgtctgagatttgcaaataggtcag |
24038516 |
T |
 |
| Q |
118 |
cacgctaattagccgcgcgatacacatggcaggctgaagtgtcccatccagggaggggggaagaga----gaccgcctcttgaagaaaaggttgattgaa |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24038517 |
cacgctaattagcagcgcgatacacatggcaggctgaagtgtcccatccagggaggggggaagagagaccgaccgcctcttgaagaaaaggttgattgaa |
24038616 |
T |
 |
| Q |
214 |
cgcatttgga |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
24038617 |
cgcatttgga |
24038626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University