View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9096_low_41 (Length: 240)

Name: NF9096_low_41
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9096_low_41
NF9096_low_41
[»] chr4 (1 HSPs)
chr4 (18-223)||(24038417-24038626)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 24038417 - 24038626
Alignment:
18 acatcatcttctagagtacattttaaactatgaggaacaacatcaaacacaatacaattaaaatgtaaggaagagtgtctgagatttgctaatagatcag 117  Q
    ||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
24038417 acatcatcttctagagtacgtttaaaactatgaggaaaaacatcaaacacaatacaattaaaatgtaaggaagagtgtctgagatttgcaaataggtcag 24038516  T
118 cacgctaattagccgcgcgatacacatggcaggctgaagtgtcccatccagggaggggggaagaga----gaccgcctcttgaagaaaaggttgattgaa 213  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||    
24038517 cacgctaattagcagcgcgatacacatggcaggctgaagtgtcccatccagggaggggggaagagagaccgaccgcctcttgaagaaaaggttgattgaa 24038616  T
214 cgcatttgga 223  Q
    ||||||||||    
24038617 cgcatttgga 24038626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University