View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_low_47 (Length: 215)
Name: NF9096_low_47
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 14743708 - 14743523
Alignment:
| Q |
10 |
gaagcagagataaaacgcctcctcgaagaagaggttaatcgtttcttcgctcccttcaaatccctcttacatctcttttttcctgctctcgctgaatgcg |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14743708 |
gaagcagagataaaacgcctcctggaagaagaggttaatcgtttcttcgctcccttcaaatccctcttacatctcttttttcctgctctcgctgaatgcg |
14743609 |
T |
|
| Q |
110 |
nnnnnnnngttggcaacatcgatgacaccgttgaattttacttcaatctcatcttcttctctgttggtggttcgtacttccctatct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14743608 |
-aaaaaaagttggcaacatcgatgacaccgttgaattttacttcaatctcatcttcttctctgttggtggttcgtacttccctatct |
14743523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University