View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9096_low_50 (Length: 210)
Name: NF9096_low_50
Description: NF9096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9096_low_50 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 23 - 210
Target Start/End: Complemental strand, 41532009 - 41531822
Alignment:
| Q |
23 |
ggattattctcatactatgtttagtccatacaaaattttcatttgatgtttagtttaatatttggtgctttcaagaccaaaaatcggtgaaatattttat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41532009 |
ggattattctcatactatgtttagtccatacaaaattttcatttgatgtttagtttaatatttggtgctttcaagaccaaaaatcggtgaaatattttat |
41531910 |
T |
 |
| Q |
123 |
gaaaatcatcatactggatatcaaacatcaatgttaaagaaatattttataagactgtaaacatattttcaataattttttattttat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531909 |
gaaaatcatcatactggatatcaaacatcaatgttaaagaaatattttataagactgtaaacatattttcaataattttttattttat |
41531822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University