View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9098_high_14 (Length: 212)
Name: NF9098_high_14
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9098_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 34861994 - 34861843
Alignment:
| Q |
1 |
ggccatgcatataaataggaaaaattaagcctaatgatttgtttgtacagattcaccacactaatggtttggaacagtttgtacagattgtatggtaatg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34861994 |
ggccatgcaaataaataggaaaaattaagcctaatgatttgtttgtacagattcaccacactaatggtttggaacagtttgtacagattgtatggtaatg |
34861895 |
T |
 |
| Q |
101 |
gtaacatttgtaaggtgtcaaataatcaacgtagcaccaataattcggattg |
152 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34861894 |
gtaacattggtaaggtgtcaaataatcaacgtagcaccaataattcggattg |
34861843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 209
Target Start/End: Complemental strand, 18485164 - 18485105
Alignment:
| Q |
150 |
ttgtgagtgcaggtggggtgagaatgtttgcttctcggattgtgattcattgagatgggc |
209 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||| ||||||||||||||||| ||||| |
|
|
| T |
18485164 |
ttgtgagtgcaggtggggtgaacatgtatgcacctcagattgtgattcattgagctgggc |
18485105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University