View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9098_low_10 (Length: 379)
Name: NF9098_low_10
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9098_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 2467810 - 2468163
Alignment:
| Q |
1 |
caatctcaaattaccaccacgctttcaattcaccaacatttttcgggctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467810 |
caatctcaaattaccaccacgctttcaattcaccaacatttttcggtctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaat |
2467909 |
T |
 |
| Q |
101 |
gcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467910 |
gcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacaca |
2468009 |
T |
 |
| Q |
201 |
gaatgtgtcttctgatgataatgatgatgcatccatgacagttttgaagtttatgctgttctctgcgttcttcgcacttcaagatgcttttccggcagtt |
300 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468010 |
gaatgtgtcttc---------tgatgatgcatccatgacagttttgaagtttatgctgttctccgcgttcttcgcacttcaagatgcttttccggcagtt |
2468100 |
T |
 |
| Q |
301 |
gctgcttctgattttgctactggtttgaattcaattcctatatttggagatgtcggtgactta |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468101 |
gctgcttctgattttgctactggtttgaattcaattcctatatttggagatgtcggtgactta |
2468163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University