View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9098_low_17 (Length: 347)
Name: NF9098_low_17
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9098_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 31465368 - 31465037
Alignment:
| Q |
1 |
gatttcatggcattggtgcaaaagcttaccgggctctctcgctcggaggaggacgacgggagcaaaaatggcaaaaatgcctcgtcatctcaatatcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31465368 |
gatttcatggcattggtgcaaaagcttaccgggctctctcgctcggaggaggacgacgggagcaaaaatggcaaaaatgcctcgtcgtctcaatatcaga |
31465269 |
T |
 |
| Q |
101 |
ccccgaagaaggagcctgtgagctgcaactacgggatgttgatcggagacaaagagaatgatcgaaaaaatgttgttttgcttagaaatgaggacagcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31465268 |
ccccgaagaaggagcctgtgagctgcaactatgggatgttgatcggagacaaagagaatgatcgaaaaaatgttgttttgcttagaaatgaggacaatga |
31465169 |
T |
 |
| Q |
201 |
cacatcctcatcagtgatcaccgatgagaataattatggtaacaacgttggtgaaaatcaagttaactcgtgtttcattccatcagatacattgatgttg |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465168 |
cacatcctcatcggtgatcaccgatgagaataattatggtaacaacgtcggtgaaaatcaggttaactcgtgtttcattccatcagatacattgatgttg |
31465069 |
T |
 |
| Q |
301 |
gagcctccgttgaacccttacatgacaaactt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31465068 |
gagcctccgttgaacccttacatgacaaactt |
31465037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University