View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9098_low_23 (Length: 304)
Name: NF9098_low_23
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9098_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 266
Target Start/End: Complemental strand, 23982726 - 23982472
Alignment:
| Q |
12 |
ataatactacttgttgcctagtggatttgatctaagtggtaaaaagacatgatttggatctaaattttttggatttgaactctacttttgtctttgaatg |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23982726 |
ataatactacttgttgagtagtggatttggtctaagtggtaaaaagacatgatttggatctaaattttttggatttgaactctacttttgtctttgaatg |
23982627 |
T |
 |
| Q |
112 |
aagataaaattaaatttatttgtaagtgttttttgagtagcattagattgagttaagggcatcgttctctaatttcaaannnnnnnatcaaaaaagttac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| ||| |
|
|
| T |
23982626 |
aagataaaattaaatttatttgtaagtgtttttttagtagcattagattgagttaagggcatcgttccctaatctcaaatttttttatcaaaaaagatac |
23982527 |
T |
 |
| Q |
212 |
tttaatattgggaatgagagttgaagatataaaaatgataatattgacctctctc |
266 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23982526 |
tttaatatttggaatgagagttgaagatataaaaattatagtattgacctctctc |
23982472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University