View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9098_low_31 (Length: 236)
Name: NF9098_low_31
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9098_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 139 - 222
Target Start/End: Complemental strand, 38561967 - 38561884
Alignment:
| Q |
139 |
tgattcattttcgttaacacatttcattcattattcctgatttcgttaaagcgagagatgaaaatgagcgtacatggaagaatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38561967 |
tgattcattttcgttaacacatttcattcattattcctgatttcgttaaagcgagagatgaaaatgagcttacatggaagaatc |
38561884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University