View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9098_low_35 (Length: 205)

Name: NF9098_low_35
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9098_low_35
NF9098_low_35
[»] chr5 (1 HSPs)
chr5 (73-190)||(36299760-36299876)


Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 73 - 190
Target Start/End: Complemental strand, 36299876 - 36299760
Alignment:
73 tacatttaggtttaaaatattttcccttcaaaaccttctcatcttagagtaattttgctcctcctctcatagtttctatcgagccaaacacatcataaag 172  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
36299876 tacatttaggtttaaa-tattttcccttcaaaaccttctcatcttagaggaattttgctcctcctctcatagtttctatcgagccaaacacatcataaag 36299778  T
173 atgcaacttatatctgtg 190  Q
    ||||||||||||||||||    
36299777 atgcaacttatatctgtg 36299760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University