View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9098_low_35 (Length: 205)
Name: NF9098_low_35
Description: NF9098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9098_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 73 - 190
Target Start/End: Complemental strand, 36299876 - 36299760
Alignment:
| Q |
73 |
tacatttaggtttaaaatattttcccttcaaaaccttctcatcttagagtaattttgctcctcctctcatagtttctatcgagccaaacacatcataaag |
172 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36299876 |
tacatttaggtttaaa-tattttcccttcaaaaccttctcatcttagaggaattttgctcctcctctcatagtttctatcgagccaaacacatcataaag |
36299778 |
T |
 |
| Q |
173 |
atgcaacttatatctgtg |
190 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36299777 |
atgcaacttatatctgtg |
36299760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University