View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9099_low_13 (Length: 312)
Name: NF9099_low_13
Description: NF9099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9099_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 296
Target Start/End: Original strand, 15632556 - 15632842
Alignment:
| Q |
16 |
agagagagatacaagcttcagtaaagaagtagacatcgaagatcttgattaagagggtgtcgaggacgaggagagcatgagagggagttatttgagggta |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15632556 |
agagagagatacaagctccagtaaagaagtagacatcgaagatcttgattaagagggtgtcgaggacgaggagagcatgagagggagttatttgaggcta |
15632655 |
T |
 |
| Q |
116 |
tgcgtcgatgagagcaagggagggagattggtcggagtcgggcatcc------tgtctgtggtatatcagtatatgcagcttggtttgtattgccctagt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15632656 |
tgcgtcgatgagagcaagggagggagattggtcggagtcgggcatcctgtctgtgtctgtggtatatcagtatatgctgcttggtttgtattgccctagt |
15632755 |
T |
 |
| Q |
210 |
aatttatccaatatttgactaatttatgatggtaatggtttgggtttatgtaatgccacagattccagaaacatggggacgtgcaca |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
15632756 |
aatttatccaatatttgactaatttatgatggtaatggtttgggtttatgtaatgccacagattccagaaacatagggacatgcaca |
15632842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University