View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9099_low_16 (Length: 302)
Name: NF9099_low_16
Description: NF9099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9099_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 25 - 284
Target Start/End: Complemental strand, 2064725 - 2064466
Alignment:
| Q |
25 |
ctcttcctctctgttgccacgctttccatgctgaatgcattgacacatggctccgttcaaatctttcatgtccgttatgtcgctccagcattctcccttc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2064725 |
ctcttcctctctgttgccacgctttccatgctgaatgcattgacacatggctccgttcaaatctttcatgtccgttatgtcgcgccagcattctcccttc |
2064626 |
T |
 |
| Q |
125 |
cgattctgatctcgcgaaaattctccgatcaacttcttcagacagtttccgagttgatatcggaaatataagccgccgtggaaacaatcttcccaatccc |
224 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064625 |
cgattctgatctcgcaaaaattctccgatcaacttcttcagacagtttccgagttgatatcggaaatataagccgccgtggaaacaatcttcccaatccc |
2064526 |
T |
 |
| Q |
225 |
gacgccgttactaccggtggcgattcaaggtcttattcaattggatcgtttgagtattat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2064525 |
gacgccgttactaccggtggcgattcaaggtcttattcgattggatcgtttgagtattat |
2064466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University