View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9099_low_23 (Length: 215)
Name: NF9099_low_23
Description: NF9099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9099_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 193
Target Start/End: Complemental strand, 56052201 - 56052012
Alignment:
| Q |
4 |
tgactcactgatctggattgtagatataagtatagcttggttactgtacaaaagttttaggcaaaaagaggaacaatgaagacgagggtataaatggaaa |
103 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||||||||||||||| | ||||||||||||||||||||| | | | |
|
|
| T |
56052201 |
tgactcactgatctggatagtagatgtaagtatagtttggtcactgtgcaaaagttttaggcaaaaagagaagcaatgaagacgagggtataaacgaaga |
56052102 |
T |
 |
| Q |
104 |
atgcaaaacattggtcatctctcttggctttcttcgctcaacagcagagaaacaaaaagttagtggatcccatggatttttggtctctct |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
56052101 |
atgcaaaatattggtcatctctcttggctttcttcgctcaagagaagagaaacaaaaagttggtgggtcctatggatttttggtctctct |
56052012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 9349755 - 9349866
Alignment:
| Q |
2 |
ggtgactcactgatctggattgtagatataagtatagcttggttactgtacaaaagttttaggcaaaaagaggaacaatgaagacgagggtataaatgga |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
9349755 |
ggtgactcactgatctggatagtagatataagtatagcttggtcactgtacaaaagttttaggcaaaaagaggagcaatgaagacaatggtataaatgga |
9349854 |
T |
 |
| Q |
102 |
aaatgcaaaaca |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9349855 |
aaatgcaaaaca |
9349866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University