View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9099_low_24 (Length: 215)

Name: NF9099_low_24
Description: NF9099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9099_low_24
NF9099_low_24
[»] chr4 (1 HSPs)
chr4 (4-193)||(56052012-56052201)
[»] chr6 (1 HSPs)
chr6 (2-113)||(9349755-9349866)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 193
Target Start/End: Complemental strand, 56052201 - 56052012
Alignment:
4 tgactcactgatctggattgtagatataagtatagcttggttactgtacaaaagttttaggcaaaaagaggaacaatgaagacgagggtataaatggaaa 103  Q
    |||||||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||||||||||||||| | ||||||||||||||||||||| | | |    
56052201 tgactcactgatctggatagtagatgtaagtatagtttggtcactgtgcaaaagttttaggcaaaaagagaagcaatgaagacgagggtataaacgaaga 56052102  T
104 atgcaaaacattggtcatctctcttggctttcttcgctcaacagcagagaaacaaaaagttagtggatcccatggatttttggtctctct 193  Q
    |||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||| |||| ||| |||||||||||||||||||    
56052101 atgcaaaatattggtcatctctcttggctttcttcgctcaagagaagagaaacaaaaagttggtgggtcctatggatttttggtctctct 56052012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 9349755 - 9349866
Alignment:
2 ggtgactcactgatctggattgtagatataagtatagcttggttactgtacaaaagttttaggcaaaaagaggaacaatgaagacgagggtataaatgga 101  Q
    |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| | ||||||||||||    
9349755 ggtgactcactgatctggatagtagatataagtatagcttggtcactgtacaaaagttttaggcaaaaagaggagcaatgaagacaatggtataaatgga 9349854  T
102 aaatgcaaaaca 113  Q
    ||||||||||||    
9349855 aaatgcaaaaca 9349866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University