View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9101_high_6 (Length: 201)
Name: NF9101_high_6
Description: NF9101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9101_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 182
Target Start/End: Complemental strand, 26211883 - 26211716
Alignment:
| Q |
15 |
ttatacttctaattcacataccaaagtggatgcttacgcttccaaggtagaaaaccaggaacagaatggaagaaagaacctttggcaaacataaattcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211883 |
ttatacttctaattcacataccaaagtggatgcttacgcttccaaggtagaaaaccaggaacagaatggaagaaagaacctttggcaaacataaattcac |
26211784 |
T |
|
| Q |
115 |
attttctaagattctttagtaaggtaatgcatgtcttaaggtgtgtaacacacgattctataccaagc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211783 |
attttctaagattctttagtaaggtaatgcatgtcttaaggtgtgtaacacacgattctataccaagc |
26211716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University