View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9101_low_10 (Length: 249)
Name: NF9101_low_10
Description: NF9101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9101_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 39115363 - 39115123
Alignment:
| Q |
9 |
attattctaaagaatcaattgtttattgttgttgataaaccaaaccctttttaaattttactacatgttaaccatgtacgatgtcacgagaatattaaga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39115363 |
attattctaaagaatcaattgtttattgttgttgataaaccaaaccctttttaaattttactacatgttaaccatgtacgatgtcacgagaatattaaga |
39115264 |
T |
 |
| Q |
109 |
ttagagaattaattattacttatacttgtgatttgaatttggttaaacatatatgtcctaatgaattttgacattgtttagtcataagtgcggtacgtga |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39115263 |
ttagagaattagttattacttatacttgtgatttgaatttggttaaacatatatgtcctaatgaattttgacattgtttagtcataagtgcggtacgtga |
39115164 |
T |
 |
| Q |
209 |
attgggatggctgaggaaaaggacagtcagcctttgaattt |
249 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39115163 |
attgggatggttgaggaaaaggacagtcagcctttgaattt |
39115123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University