View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9103_low_5 (Length: 210)

Name: NF9103_low_5
Description: NF9103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9103_low_5
NF9103_low_5
[»] chr2 (1 HSPs)
chr2 (1-165)||(16549289-16549453)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 16549289 - 16549453
Alignment:
1 tcataaaataattgacgaaatttaacaaaattcttaatggtttggtgaacattcaggatgaagacaacactttactttttgtgtgcaatacctagatcct 100  Q
    |||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16549289 tcataaaacaattgatgaagtttaacaaaattcttaatggtttggtgaacattcaggatgaagacaacactttactttttgtgtgcaatacctagatcct 16549388  T
101 ttgagcactttaaggaaggataccatgctttatgctaaagaactcaccatcaccttggatgaagt 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
16549389 ttgagcactttaaggaaggataccatgctttatgctaaagaactcaccatcaccctggatgaagt 16549453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University