View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9103_low_6 (Length: 210)
Name: NF9103_low_6
Description: NF9103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9103_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 16549289 - 16549453
Alignment:
| Q |
1 |
tcataaaataattgacgaaatttaacaaaattcttaatggtttggtgaacattcaggatgaagacaacactttactttttgtgtgcaatacctagatcct |
100 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16549289 |
tcataaaacaattgatgaagtttaacaaaattcttaatggtttggtgaacattcaggatgaagacaacactttactttttgtgtgcaatacctagatcct |
16549388 |
T |
|
| Q |
101 |
ttgagcactttaaggaaggataccatgctttatgctaaagaactcaccatcaccttggatgaagt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16549389 |
ttgagcactttaaggaaggataccatgctttatgctaaagaactcaccatcaccctggatgaagt |
16549453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University