View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9105_high_5 (Length: 252)
Name: NF9105_high_5
Description: NF9105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9105_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 246249 - 246008
Alignment:
| Q |
1 |
ctaagtgtgtatgatagattgaagaaaatgataaatatttctaaataaatgattcttatatgttgcttgtagcataaggtcaacaattgataggtacaaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
246249 |
ctaagtgtgtaagatagattgaagaaaatgataaatatttctaaat----gattcttatgtgttgcttgtagcataaggtcaacaattgataggtacaaa |
246154 |
T |
 |
| Q |
101 |
aaagcttgttcagatcattcaagtaccaccactaccactgaaattaacgctcaggtaaccaaattacac----atggctagtttgaattgattcagtttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
246153 |
aaagcttgttcagatcattcaagtaccaccactaccactgaaattaacgctcaggtaaccaaattacacattaatatctagtttgaattgattcagtttt |
246054 |
T |
 |
| Q |
197 |
atttatatatcattttaaatgagttcaataatttggcagtattatc |
242 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
246053 |
atttatatatcattttaaacgagttcaataatttggcagtattatc |
246008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University