View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9107_low_11 (Length: 280)

Name: NF9107_low_11
Description: NF9107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9107_low_11
NF9107_low_11
[»] chr5 (1 HSPs)
chr5 (61-265)||(30968074-30968260)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 61 - 265
Target Start/End: Complemental strand, 30968260 - 30968074
Alignment:
61 cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30968260 cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa 30968161  T
161 ttgaagccatagaaagaaatgatacatgggaactaactgatttaccaactggaagcaggaagattagtgtaaaatggatttataagac--aatacaatga 258  Q
    ||||||||||||||||||||||                    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
30968160 ttgaagccatagaaagaaatga--------------------taccaactggaagcaggaagattagtgtaaaatggatttataagacaaaatacaatga 30968081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University