View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9107_low_14 (Length: 249)
Name: NF9107_low_14
Description: NF9107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9107_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 45977721 - 45977960
Alignment:
| Q |
1 |
gagatatcatggaatgatttacggattaaagagcgtgttggtgctggtaatttttctgcttcttgaattcacgtagatttggtataaaaacctgtttcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45977721 |
gagatatcatggaatgatttacggattaaagagcgtgttggtgctggtaatttttctgcttcttgaattcacgtagatttggtataaaaacctatttcct |
45977820 |
T |
 |
| Q |
101 |
catttggtgactctaaatgctcctgtccttttaactatgtaggctcattcggaactgtgcaccatgctgagtggcatggatcagtaagtcataatttatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45977821 |
catttggtgactctaaatgctcctgtccttttatctatgtaggctcattcggaactgtgcaccatgctgagtggcatggatcagtaagtcataatttatt |
45977920 |
T |
 |
| Q |
201 |
cgtacagtaagcacattcgagtgtataaacacaggttctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45977921 |
cgtacagtaagcacattcgagtgtataaacacagtttctg |
45977960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University