View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9107_low_16 (Length: 203)
Name: NF9107_low_16
Description: NF9107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9107_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 14 - 182
Target Start/End: Original strand, 50229691 - 50229859
Alignment:
| Q |
14 |
aagcagagaacctttttgaagaattttgnnnnnnnnggggtattacttgtaatcttaaataatcttttgagtatttttatagataatcacgaagctttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229691 |
aagcagagaacctttttgaagaattttgttttttttggggtattacttgtaatcctaaataatcttttgagtatttttatagataatcacgaagctttct |
50229790 |
T |
|
| Q |
114 |
acgaggatgccgagcttagaaagcagaatgaaggtactcagagaaattgcttctgagaacaatattact |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229791 |
acgaggatgccgagcttagaaagcagaatgaaggtactcagagaaattgcttctgagaacaatattact |
50229859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University