View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9109_high_7 (Length: 210)
Name: NF9109_high_7
Description: NF9109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9109_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 26203778 - 26203590
Alignment:
| Q |
1 |
acgcataccaaacactcaaatnnnnnnntcaattcaactccaactaactccaccagccaccaccatgacgacggcgatctcggtggcggaacccgaactg |
100 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203778 |
acgcataccaagcactcaaataaaaaaatcaattcaactc-aactaactccaccagccaccaccatgacgacggcgatctcggtggcggaacccgaactg |
26203680 |
T |
|
| Q |
101 |
aaaacatactggtgccacgaatgtgacatgagcgtttctttaactacttctcacaccccctctcctctactctgtccccattgcgacact |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203679 |
aaaacatactggtgccacgaatgtgacatgagtgtttctttaactacttctctcaccccctctcctctactctgtccccattgcgacact |
26203590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University