View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9109_low_7 (Length: 336)
Name: NF9109_low_7
Description: NF9109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9109_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 10 - 336
Target Start/End: Complemental strand, 26239746 - 26239416
Alignment:
| Q |
10 |
atgagtggactgtgatatagacatgccctaaattcactaaattagggtcgagtaggctaatttgtacaattcaaactgaatccaatgctaaattgtcatc |
109 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26239746 |
atgagtggactatgatatagacatgccctaaattcactaaatcagggtcgagtaggctaatttgtacaattcaaactgaatccaaagctaaattgtcatc |
26239647 |
T |
|
| Q |
110 |
atatgctcatagttgtccaccgaggacagttgtctgagtaaaggtttgagcgctagaaaccctggttat----tcactataaagggtaacttgtagctgc |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
26239646 |
atatgctcgtagttgtccaccgaggacagttgtctgagtaaaagtttgagcgctagaaaccctagttattcactcactataaagggtaacttgtagctgc |
26239547 |
T |
|
| Q |
206 |
ttcatgatacacactttcaaccctaacacctcgcgtatttaacacatttttaatcgttagagtgtttgcatgaatctcctagaagaagaaaactgctaat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
26239546 |
ttcatgatacacactttcaaccctaacacctcgcgtatttaacacattcttaatcgttagagtgtttgcatgaatctcctaaaagaagaaaactgttaat |
26239447 |
T |
|
| Q |
306 |
ctagggttagaggttacgcgtcgtcaccacc |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
26239446 |
ctagggttagaggttccgcgtcgtcaccacc |
26239416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University