View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9111_low_2 (Length: 471)
Name: NF9111_low_2
Description: NF9111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9111_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 10 - 459
Target Start/End: Original strand, 11312915 - 11313364
Alignment:
| Q |
10 |
tcatcaacatgttcttcaaacttcgtgccttctctatcgtggctggaagtagatgttctttaacgaaggtccagatctcatacgcagtgtcaccattgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11312915 |
tcatcaacatgttcttcaaacttcgtgccttctctatcgtggctggaagtagctgttctttaacggaggtccagatctcatacgcagtgtcaccattgat |
11313014 |
T |
|
| Q |
110 |
catggtcaatacttcttccttcatggttccgagtagccatgaacataggagaccatcattggtgatccactttgaatagttcggatttggactcttttca |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313015 |
catggtcaacacttcttccttcatggttccgagtagccatgaacataggagaccatcattggtgatccactttgaatagttcggatttggactcttttca |
11313114 |
T |
|
| Q |
210 |
ctcgtggcacccttgacttccttttctggtttttcttcactcaatagatggtgaagaacaccgagacttcgaactaagggtgtgatttgattacgccaca |
309 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313115 |
cccgtggcacccttgacttcctcttctggtttttcttcactcaatagatggtgaagaacaccgagacttcgaactaagggtgtgatttgattacgccaca |
11313214 |
T |
|
| Q |
310 |
atatgaaattgtttgtgctcagtttcatggagataaaacttgaacattggtggaatgattggatgctaagttctggttctgtttttggaagggatgtgtt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11313215 |
atatgaaattgtttgtgctcagtttcatggagataaaacttgaacattggtgaaatgattggatgctaagttctggttctgtttttgggagggatgtgtt |
11313314 |
T |
|
| Q |
410 |
ggtaatgcttgaagacatgatgtgtttggcttgcaagtttacaggctctg |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313315 |
ggtaatgcttgaagacatgatgtgtttggcttgcaagtttacaggctctg |
11313364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University