View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9112_high_17 (Length: 257)
Name: NF9112_high_17
Description: NF9112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9112_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 168 - 243
Target Start/End: Original strand, 1230264 - 1230339
Alignment:
| Q |
168 |
atgaaatcaaaagcttaaactgaactggaacgaatttgaaactgaaatcgaagacgagccactaccagaacacgaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1230264 |
atgaaatcaaaagcttaaactgaactggaacgaatttgaaactgaaatcgaagacgagccactaccagaacacgaa |
1230339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 6 - 77
Target Start/End: Original strand, 1230102 - 1230173
Alignment:
| Q |
6 |
catcgtggtgggtacgggtgttcacacgataagaatccccaaatttgttgtatgatggaaccaagagtactt |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1230102 |
catcgtggtgggtacgggtgttcacacgataagaatccccaaatttgttgtatgatggaaccaagagtactt |
1230173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 7 - 77
Target Start/End: Complemental strand, 1230101 - 1230031
Alignment:
| Q |
7 |
atcgtggtgggtacgggtgttcacacgataagaatccccaaatttgttgtatgatggaaccaagagtactt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1230101 |
atcgtggtgggtacgggtgttcacacgataagaatccccaaatttgttgtatgatggaaccaagagtactt |
1230031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 168 - 243
Target Start/End: Original strand, 8079210 - 8079284
Alignment:
| Q |
168 |
atgaaatcaaaagcttaaactgaactggaacgaatttgaaactgaaatcgaagacgagccactaccagaacacgaa |
243 |
Q |
| |
|
||||||||||||||| ||||||||| |||| ||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
8079210 |
atgaaatcaaaagctgaaactgaacaggaaagaattcgaaactgaaatcgaagacga-acaataccagaacacgaa |
8079284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University