View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9112_high_21 (Length: 221)
Name: NF9112_high_21
Description: NF9112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9112_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 1229978 - 1230166
Alignment:
| Q |
15 |
cagagatactgagtaacttttatgatggtgtgtatatatgattttgattttgattaatagttttcgatttgtagaaaaagcagtggattttctagaggag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1229978 |
cagagatactgagtaacttttatgatggtgtgtatatatgattttgattttgattaatagttttcgatttgtagaaaaagcagtggattttctagaggag |
1230077 |
T |
 |
| Q |
115 |
tctcaaaatacagaggtgtagcaaggtaccactattttcattgcaaaatggaagtttttctattgtttgtatctcttcaatgtcaataa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1230078 |
tctcaaaatacagaggtgtagcaaggtaccactattttcattgcaaaatggaagtttttctattgtttgtatctcttcaatgtcaataa |
1230166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 142
Target Start/End: Complemental strand, 24989983 - 24989937
Alignment:
| Q |
96 |
agtggattttctagaggagtctcaaaatacagaggtgtagcaaggta |
142 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||| ||||||||||| |
|
|
| T |
24989983 |
agtggattttctagaggtgtatcaaaatatagaggagtagcaaggta |
24989937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 141
Target Start/End: Original strand, 2051718 - 2051772
Alignment:
| Q |
87 |
agaaaaagcagtggattttctagaggagtctcaaaatacagaggtgtagcaaggt |
141 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| || |||||||| ||||||| |
|
|
| T |
2051718 |
agaaaaagcagtggcttttcaagaggtgtctcaaagtatagaggtgttgcaaggt |
2051772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University