View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9112_low_25 (Length: 360)
Name: NF9112_low_25
Description: NF9112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9112_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 346
Target Start/End: Original strand, 7463391 - 7463723
Alignment:
| Q |
17 |
aaaaataatgcaattgggtgggtcacatgctaattttttatttagcatgattatcttgaggcatgtaaaataaagacatatccgttggttgtcgcatttt |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7463391 |
aaaaataatgcaattgggttggtcacatgctaattttttatttagcatgcttatcttgaggcatgtaaaataaagacatatccgttggttgttgcatttt |
7463490 |
T |
 |
| Q |
117 |
atttcggttgttacatgtgccagcctaggttgtcgctttttaaattaatttcactatattgttgctaattttgttataggnnnnnnnttgtttcgtattc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7463491 |
atttcggttgttacatgtgccagcctaggttgtcactttttaaattaatttcactatattgttgctaattttgtaataggaaaaaaattgtttcgtattc |
7463590 |
T |
 |
| Q |
217 |
gtatttttgttaaataatgttgttttcacatgagcaaagctccttgcaaattttcacgtgcatatactcgtatgaaacttcatttaaatacactaatga- |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7463591 |
gtatttttgttaaataatgttgttttcacatgggcaaagctccttgcaaattttcacgtgcatatactcgtatgaaacttcatttaaatacactaatgaa |
7463690 |
T |
 |
| Q |
316 |
--gttaaatcaactaaactaaactgttttcaca |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7463691 |
ttgttaaatcaactaaactaaactgttttcaca |
7463723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University