View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9112_low_27 (Length: 355)
Name: NF9112_low_27
Description: NF9112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9112_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 274 - 345
Target Start/End: Complemental strand, 34930001 - 34929930
Alignment:
| Q |
274 |
ccacacatgtattgccacatcctctaatttgtcatctcattattaaagcaaaaatagaccccaatatctgtg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34930001 |
ccacacatgtattgccacatcctctaatttgtcatctcattattaaagcaaaaatagaccccaatatctgtg |
34929930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 19 - 91
Target Start/End: Complemental strand, 34930337 - 34930265
Alignment:
| Q |
19 |
atatagcttgtgtatgagatcatgcgaaaataacttctagtgtatattgaattactttaattttaggttttgt |
91 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34930337 |
atatagcttgtgtatgagatcatgcaaaaataacttctagtgtatattgaattactttaattttaggttttgt |
34930265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 34930167 - 34930102
Alignment:
| Q |
104 |
aaaggttcattttttatgttttgtcaatctggataatgtaagtcattggatgatgttgcaatgtat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34930167 |
aaaggttcattttttatgttttgtcaatctggataatgtaagtcattggatgatgttgcaatgtat |
34930102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University