View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9112_low_37 (Length: 274)
Name: NF9112_low_37
Description: NF9112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9112_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 46568663 - 46568463
Alignment:
| Q |
1 |
cattggagtaaattaaggatgaaggatcttatagaagatgaagagaatgaaataaggaatcagagtttggagcactcattgctgaaattaatgtagtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46568663 |
cattggagtaaattaaggatgaaggatcttatagaagatgaagagaatgaaataaggaatcagagtttggaggactcattgctgaaattaatgtagtgtt |
46568564 |
T |
 |
| Q |
101 |
aaaattgtgaatgacgcttaattttttggaaaaagaacgttgaagatagtttcgtgaaattgcatttctagacacaaggccaatgtgtccaccacttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
46568563 |
aaaattgtgaatgacgcttaattttttggaaaaagaacgttgaagatagtttcgtgaaattgcatttctagatacaatgccaatgtgtccatcacttgat |
46568464 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
46568463 |
a |
46568463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 198 - 255
Target Start/End: Complemental strand, 46568427 - 46568370
Alignment:
| Q |
198 |
gataaaattgaagagcacccaagaagggtaataagacgagaatactcctcttctcccc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46568427 |
gataaaattgaagagcacccaagaagggtaataagacgagaatactcctcttctcccc |
46568370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University