View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9114_high_5 (Length: 268)

Name: NF9114_high_5
Description: NF9114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9114_high_5
NF9114_high_5
[»] chr2 (1 HSPs)
chr2 (91-253)||(29641839-29642001)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 91 - 253
Target Start/End: Complemental strand, 29642001 - 29641839
Alignment:
91 gaccttggtttccaaaactaagcaagagtgtgcatgcagaggaaccaatggagagaagctccctaatgagaaattatagaaatgaaatgaagtgaaaaat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29642001 gaccttggtttccaaaactaagcaagagtgtgcatgcagaggaaccaatggagagaagctccctaatgagaaattatagaaatgaaatgaagtgaaaaat 29641902  T
191 agctatagtttgataaaatatgtgactataatagagacaaaataagtatggggcctaaaaatt 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29641901 agctatagtttgataaaatatgtgactataatagagacaaaataagtatggggcctaaaaatt 29641839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University