View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9114_high_7 (Length: 263)
Name: NF9114_high_7
Description: NF9114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9114_high_7 |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 123 - 237
Target Start/End: Original strand, 2551548 - 2551665
Alignment:
| Q |
123 |
aaaactgccatacttactgttatataaaggacctaaaaattct---tatcactagtccaagtgaagacttgcaatgaagtatgtaggaggattaagattg |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2551548 |
aaaactggcatacttactgttatataaaggacctaaaaattcttcttatcactagtccaagtgaagacttccaatgaagtatgtaggaggattaagattg |
2551647 |
T |
 |
| Q |
220 |
atagcaaatagtaggtgt |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2551648 |
atagcaaatagtaggtgt |
2551665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 103 - 228
Target Start/End: Original strand, 2559163 - 2559292
Alignment:
| Q |
103 |
tttgatattttatttttgataaaactgccatacttactgttatataaaggacctaaaaattctt---atcactagtccaagtgaagacttgcaatgaagt |
199 |
Q |
| |
|
|||||| |||||||||||||||||| | |||||||||| ||||| |||||| |||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
2559163 |
tttgatgttttatttttgataaaaccggcatacttactattatacgaaggactgaaaaatccttcgtattactagtccaagtgaagacttgcaatgaagt |
2559262 |
T |
 |
| Q |
200 |
atgtaggaggat-taagattgatagcaaat |
228 |
Q |
| |
|
||||||||||| |||| ||||||| |||| |
|
|
| T |
2559263 |
ctgtaggaggatctaaggttgataggaaat |
2559292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 146
Target Start/End: Complemental strand, 15994 - 15948
Alignment:
| Q |
103 |
tttgatattttatttttgataaaactgcc---atacttactgttata |
146 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
15994 |
tttgatattttatttttgataaaactggcataatacttactgttata |
15948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University