View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9114_low_10 (Length: 273)
Name: NF9114_low_10
Description: NF9114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9114_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 58 - 242
Target Start/End: Complemental strand, 9975664 - 9975483
Alignment:
| Q |
58 |
acttatgttttatcatgtattatatattaaatacttccaacacttccatatgatttgtatcnnnnnnnnnnnnnnacaatgataacgtaccaaaccaacc |
157 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9975664 |
acttatgttttatcatatattatatattaaatacttccaacacttccatatgatttgtatctaattgttttt---acaatgataacgtaccaaaccaacc |
9975568 |
T |
 |
| Q |
158 |
attaactaatattccatgtttccacaaaataattatacaggcaacagagattcagatgcacactcacaaatctcatacaacttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9975567 |
attaactaatattccatgtttccacaaaataattatacaggcaacagagattcagatgcacactcacaaatctcatacaacttct |
9975483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 242
Target Start/End: Original strand, 7113053 - 7113103
Alignment:
| Q |
192 |
atacaggcaacagagattcagatgcacactcacaaatctcatacaacttct |
242 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7113053 |
atacaagcaacggagattcagatgcacactcacaaattccatacaacttct |
7113103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 227
Target Start/End: Original strand, 19855786 - 19855814
Alignment:
| Q |
199 |
caacagagattcagatgcacactcacaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19855786 |
caacagagattcagatgcacactcacaaa |
19855814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University