View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9114_low_17 (Length: 244)
Name: NF9114_low_17
Description: NF9114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9114_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 48817425 - 48817204
Alignment:
| Q |
11 |
gattattctagagagaggtttgaggcaaggcggtccattattaccttgtttttatttttatt------attaaatgtgcatatggccatttttctctcat |
104 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48817425 |
gattattctagggagaggtttgaggcaaggcggtccattattaccttgtttttatttttatttttattattaaatgtgcatatggccatttttctctcat |
48817326 |
T |
|
| Q |
105 |
taatcgtacagaggtgaggggagggtggaattgcatgaaaccaagatatgcctggatgtacctattgttactcacttcttacagatggnnnnnnnnnctt |
204 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48817325 |
taaacgtacagaggtgaggggagggtggaattgcatgaaaccaagatatgcctggatgtacctattgttactcacttcttacagatggttgtcttttctt |
48817226 |
T |
|
| Q |
205 |
cttcaaggttgacgatcatgaa |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48817225 |
cttcaaggttgacgatcatgaa |
48817204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University