View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9114_low_18 (Length: 239)
Name: NF9114_low_18
Description: NF9114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9114_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 25537836 - 25537613
Alignment:
| Q |
1 |
aacctagctatgattcgtgatattttcgctgaagtttttaagagtgtttggaaggtttttcctaagattattttcatat---gtaaggtcttagaaataa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
25537836 |
aacctagctatgattcgtgatattttcgctgaagtttttaagagtgtttggaaggtttttcctaagattcttttcatattgtgtaaggtcttagaaataa |
25537737 |
T |
|
| Q |
98 |
gagggtttttcctaaaatttcagggctagttacatagtcaaatgttgtaatgtgtcagtctttatatgaacaagtattcaagggatgttctgtccctttc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25537736 |
gagggtttttcctaaaatttcagggctagttacatagtcaaatgttgtaatgtgtcggtctttatatgaacaagtattcaagggatgttctgtccctttc |
25537637 |
T |
|
| Q |
198 |
cttcatatgaatgaatgtgttgcc |
221 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
25537636 |
cttcatatgaatgagtgtgttgcc |
25537613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 85 - 221
Target Start/End: Complemental strand, 25525228 - 25525089
Alignment:
| Q |
85 |
gtcttagaaataagagggtttttcctaaaatttcaggg-ctagttacatagtcaaatgttgtaatgtgtcag--tctttatatgaacaagtattcaaggg |
181 |
Q |
| |
|
|||||||||||||||||||||||| ||| | ||| ||| |||||||| | |||| | | |||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
25525228 |
gtcttagaaataagagggtttttcttaagaattctggggctagttacttggtcacacatcataatgtgtcacattcttgatatgaacacatattcaaggg |
25525129 |
T |
|
| Q |
182 |
atgttctgtccctttccttcatatgaatgaatgtgttgcc |
221 |
Q |
| |
|
|||| |||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
25525128 |
atgtcctgtcccttttcttcatatgactgagtgtgttgcc |
25525089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 142 - 221
Target Start/End: Original strand, 25516924 - 25517005
Alignment:
| Q |
142 |
ttgtaatgtgtcag--tctttatatgaacaagtattcaagggatgttctgtccctttccttcatatgaatgaatgtgttgcc |
221 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||||||| |||| |||| ||| ||||||||| |
|
|
| T |
25516924 |
ttgtaatgtgtcacattcttgatatgaacaagtatcaaagggatgttctgtcccttttcttcttatggctgagtgtgttgcc |
25517005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University