View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_1D_high_11 (Length: 296)
Name: NF9115_1D_high_11
Description: NF9115_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_1D_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 45917017 - 45916736
Alignment:
| Q |
7 |
ttattttcattcaatcttcttaattaaacaaactcatgcatattacatgtttgtttatttatttatttacaacatcttcgttattttccctcaatgaaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45917017 |
ttattttcattcaatcttcttaattaaacaaactcatgcatattacatgtttgtttatttatttatttacaccatcttcgttattttccctcaatgaaac |
45916918 |
T |
 |
| Q |
107 |
agaaacgattgtgaagaacagagcaaaatcagagagtgagaatattgcatgatgcatctagaaaacacacctacttttcatggctttcacatgcctgcag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45916917 |
agaaacgattgtgaagaacagagcaaaatcagagagtgagaatattgcatgatgcatctagaaaacacacctacttttcatggctttcacatgcctgcag |
45916818 |
T |
 |
| Q |
207 |
aatgggaacctcactcacagtgttggattggttggcccgtaagtatttttatttacttcgcacatactccatgcttcatctc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45916817 |
aatgggaacctcactcacagtgttggattggttggcccgtaagtatttttatttacttcgcacatactccatgcttcttctc |
45916736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 184 - 252
Target Start/End: Complemental strand, 45910110 - 45910042
Alignment:
| Q |
184 |
tcatggctttcacatgcctgcagaatgggaacctcactcacagtgttggattggttggcccgtaagtat |
252 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
45910110 |
tcatggctttcacatgccttcagaatgggaacctcactctcagtgttggatgggttgtcccgtaagtat |
45910042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University