View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_1D_high_14 (Length: 242)
Name: NF9115_1D_high_14
Description: NF9115_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_1D_high_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 50507483 - 50507256
Alignment:
| Q |
17 |
gaacttctgggttgaactcttagatcgtgttatacgacccgtggagttagacatggaagccttttgtgttaagtcctctcttctcatttcccagatatgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
50507483 |
gaacttctgggttgaactcttagatcgtgttatacgacccgtggagttagacatggaagccttttgtgttaagtcctctcttctcgtttcccggatatgc |
50507384 |
T |
|
| Q |
117 |
tgctcttcctatagtaaattgtgatcattgtcagaactatcaaatattaaaggaaaatgctacgaggtacgat--nnnnnnngcaaacgacctaggcaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50507383 |
tgctcttcctatagtaaattgtgatcattgtcagaactatcaaatattaaaggaaaatgctacgaggtacgataaaaaaaaagcaaacgacctaggcaca |
50507284 |
T |
|
| Q |
215 |
atctcttgctttttcacctagcctattt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
50507283 |
atctcttgctttttcacctagcctattt |
50507256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 110 - 238
Target Start/End: Original strand, 10784098 - 10784226
Alignment:
| Q |
110 |
gatatgctgctcttcctatagtaaattgtgatcattgtcagaactatcaaatattaaaggaaaatgctacgaggtacgatnnnnnnngcaaacgac---- |
205 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
10784098 |
gatatgttgctcctcctgtagtaaattgtgatcattgtcagaactatcaaatattaaaggaaaatgctatgaggtatgat----aaagcaaacgacctag |
10784193 |
T |
|
| Q |
206 |
ctaggcacaatctcttgctttttcacctagcct |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
10784194 |
ctaggcacaatctcttgcttttttacctagcct |
10784226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 32 - 106
Target Start/End: Original strand, 10783990 - 10784064
Alignment:
| Q |
32 |
actcttagatcgtgttatacgacccgtggagttagacatggaagccttttgtgttaagtcctctcttctcatttc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
10783990 |
actcttagatcgtgttatacgacccgtggagttagacatggaatcttttttagttaagtcctctcttctcatttc |
10784064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University