View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9115_1D_low_21 (Length: 228)

Name: NF9115_1D_low_21
Description: NF9115_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9115_1D_low_21
NF9115_1D_low_21
[»] chr8 (1 HSPs)
chr8 (112-148)||(37184616-37184652)


Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 112 - 148
Target Start/End: Complemental strand, 37184652 - 37184616
Alignment:
112 ctgtctctgctagaagtagaaagcaaataacaccaaa 148  Q
    |||||||||||||||||||||||||||||||||||||    
37184652 ctgtctctgctagaagtagaaagcaaataacaccaaa 37184616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University