View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_1D_low_21 (Length: 228)
Name: NF9115_1D_low_21
Description: NF9115_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_1D_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 112 - 148
Target Start/End: Complemental strand, 37184652 - 37184616
Alignment:
| Q |
112 |
ctgtctctgctagaagtagaaagcaaataacaccaaa |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37184652 |
ctgtctctgctagaagtagaaagcaaataacaccaaa |
37184616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University