View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9115_1D_low_23 (Length: 224)

Name: NF9115_1D_low_23
Description: NF9115_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9115_1D_low_23
NF9115_1D_low_23
[»] chr1 (1 HSPs)
chr1 (23-115)||(25814370-25814462)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 115
Target Start/End: Original strand, 25814370 - 25814462
Alignment:
23 atgtagaccttatactatgtcaaacatagcttgaattgtgatcaattaaactgagctccaagaaaatcaccattcaaaaaatatttgctttta 115  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25814370 atgtagaccttatagtatgtcaaacatagcttgaattgtgatcaattaaactgagctccaagaaaatcaccattcaaaaaatatttgctttta 25814462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University