View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_1D_low_23 (Length: 224)
Name: NF9115_1D_low_23
Description: NF9115_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_1D_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 115
Target Start/End: Original strand, 25814370 - 25814462
Alignment:
| Q |
23 |
atgtagaccttatactatgtcaaacatagcttgaattgtgatcaattaaactgagctccaagaaaatcaccattcaaaaaatatttgctttta |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814370 |
atgtagaccttatagtatgtcaaacatagcttgaattgtgatcaattaaactgagctccaagaaaatcaccattcaaaaaatatttgctttta |
25814462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University