View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_high_10 (Length: 329)
Name: NF9115_2D_high_10
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 82 - 267
Target Start/End: Complemental strand, 19785339 - 19785157
Alignment:
| Q |
82 |
ttcttcttcttagagaaaaagggtttgatggttgcaaacgcttatttttggatccagatttcctttcattccactcttctttctggatttcacgaattcc |
181 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19785339 |
ttcttgttcttagagcaaaagggtttgatggttgcaagcgcttatt---ggatccagatttcctttcattccactcttctttctggatttcacgaattcc |
19785243 |
T |
 |
| Q |
182 |
agaaccttggagaatacggtatagaatttcagggagatctttgaagtaaccaaagtgagcaagtgtaggaacattggtagctaggg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
19785242 |
agaaccttggagaatacggtatagaatttcagggagatctttgaagtaaccaaagtcagcaagtgtaggaacattggtagttaggg |
19785157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 127 - 326
Target Start/End: Original strand, 19796305 - 19796504
Alignment:
| Q |
127 |
ttttggatccagatttcctttcattccactcttctttctggatttcacgaattccagaaccttggagaatacggtatagaatttcagggagatctttgaa |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||| |||| | ||||||||| ||||| |||||| || || ||||||||||||||||| |
|
|
| T |
19796305 |
ttttggatccagatttcctttccctccactcttctttctgtgttttgcgaacttcagaaccttcgagaagacggtagaggatctcagggagatctttgaa |
19796404 |
T |
 |
| Q |
227 |
gtaaccaaagtgagcaagtgtaggaacattggtagctagggttttagggtgattttcatgaaaccatagagcagcggcgtagaagccttctttgtcggac |
326 |
Q |
| |
|
||| ||||||| ||| || | ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||| |
|
|
| T |
19796405 |
gtagccaaagtcagcgagagaaggaacattggtagctagggttttagggtgattttcatgaaaccagagagcggcggcgtagaagccttctttgttggac |
19796504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 22 - 90
Target Start/End: Complemental strand, 19796695 - 19796627
Alignment:
| Q |
22 |
atggggtttaccgaaaacatgtcaccaacatttctctacaccggtaacccttgcctcgatttcttcttc |
90 |
Q |
| |
|
|||||||| || || |||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19796695 |
atggggttgacagagaacatgtcaccaacgtttctctccaccggtaacccttgcctcgatttcttcttc |
19796627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 152 - 319
Target Start/End: Original strand, 15835568 - 15835735
Alignment:
| Q |
152 |
ccactcttctttctggatttcacgaattccagaaccttggagaatacggtatagaatttcagggagatctttgaagtaaccaaagtgagcaagtgtagga |
251 |
Q |
| |
|
||||||||||||||| |||| |||| | || |||||| ||||| |||||| || || ||||||||||||||||||||||||||| ||| | || || | |
|
|
| T |
15835568 |
ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa |
15835667 |
T |
 |
| Q |
252 |
acattggtagctagggttttagggtgattttcatgaaaccatagagcagcggcgtagaagccttcttt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
15835668 |
acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttcttt |
15835735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 22 - 90
Target Start/End: Complemental strand, 15835933 - 15835865
Alignment:
| Q |
22 |
atggggtttaccgaaaacatgtcaccaacatttctctacaccggtaacccttgcctcgatttcttcttc |
90 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
15835933 |
atggggttcaccgagaacatgtcaccgacatttctctccaccggtaacccatgccttgatttcttcttc |
15835865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 139 - 316
Target Start/End: Original strand, 47713369 - 47713546
Alignment:
| Q |
139 |
atttcctttcattccactcttctttctggatttcacgaattccagaaccttggagaatacggtatagaatttcagggagatctttgaagtaaccaaagtg |
238 |
Q |
| |
|
||||| ||| |||||| |||||||||||||||| ||| || | |||||| |||| |||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
47713369 |
atttcttttgattccattcttctttctggattttacgtatattggtaccttgcagaagacggtaaaggatttctgggagatctttgaagtaaccaaagtc |
47713468 |
T |
 |
| Q |
239 |
agcaagtgtaggaacattggtagctagggttttagggtgattttcatgaaaccatagagcagcggcgtagaagccttc |
316 |
Q |
| |
|
|||||| | ||| || || | |||||||||||||||||| | | |||||||| ||||||||||||||||| ||||| |
|
|
| T |
47713469 |
agcaagggaagggacgttagaagctagggttttagggtggtagtggtgaaaccaaagagcagcggcgtagaaaccttc |
47713546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University