View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_high_11 (Length: 300)
Name: NF9115_2D_high_11
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 43073828 - 43073544
Alignment:
| Q |
1 |
gaagtctgaacataaaggttgtaggatgacatggtttgatttaactttcttgattcttgaagactttggaccttgttattcgtttatttgaaccttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43073828 |
gaagtctgaacataaaggttgtaggatgacatggtttgatttaactttcttgattcttgaagactttggaccttgttattcgtttatttgaaccttcact |
43073729 |
T |
 |
| Q |
101 |
cttcctctttgtgtaattaactatgttactgcacctgcataggccgaaaattatggggttttccgaggtttgctggtgactgtgctaatggacacaagaa |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43073728 |
cttactctttgtgtaattaactatgttactgcacctgcataggccgaaaattatggggttttccgaggtttgctggtgactgtgctaatggacacaagaa |
43073629 |
T |
 |
| Q |
201 |
gtcaataatcctgggagctagttcagagcacaaaaatgatataactgattcttgctctcaaatgatccttcagctccatgatgtc |
285 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43073628 |
gtcaacaatcctgggagctagttcagagcacaaaaatgatataactgattcttgctctcaaatgatccttcagctccatgatgtc |
43073544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 237 - 285
Target Start/End: Original strand, 5379983 - 5380031
Alignment:
| Q |
237 |
tgatataactgattcttgctctcaaatgatccttcagctccatgatgtc |
285 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5379983 |
tgatatcactgattcttgctctcagatgatccttcagctccatgatgtc |
5380031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University