View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_low_26 (Length: 264)
Name: NF9115_2D_low_26
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 26608241 - 26608457
Alignment:
| Q |
20 |
gatggcacgaccaacggaaggctgtgaggcaagacgacacagctagttgggtgaaaaaac--gggttgtgtttcaattagtcaatgatgcgcaagattgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608241 |
gatggcacgaccaacggaaggctgtgaggcaagacgacacagctagttgggtgaaaaaacaggggttgtgtttcaattagtcaatgatgcgcaagattgc |
26608340 |
T |
|
| Q |
118 |
attgcaggacgaagtggcgaaacagtgctgcagaagggagcgtcaagatggcgtggtgagacggaagatcaaaataggttccaagttcacgagtaggatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608341 |
attgcaggacgaagtggcgaaacagtgcagcagaagggagcgtcaagatggcgtggtgagacggaagatcaaaataggttccaagttcacgagtaggatt |
26608440 |
T |
|
| Q |
218 |
gtgtttcaatcaatctg |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26608441 |
gtgtttcaatcaatctg |
26608457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University