View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_low_28 (Length: 262)
Name: NF9115_2D_low_28
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 65 - 243
Target Start/End: Original strand, 22198859 - 22199037
Alignment:
| Q |
65 |
ttcatgttgcagaagctttgcgaaggaacttggctacctatctcttttataagatggatctagagctgttgacaaatagagtgaaaaaacacttgaacaa |
164 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||| | ||||||||||||||||||| |||| |
|
|
| T |
22198859 |
ttcatgttgtagaagctttgcgaaggaactgggctacctatggcttttataagatggatctagagccgttgaaagttagagtgaaaaaacacttgcacaa |
22198958 |
T |
|
| Q |
165 |
aaaacggtatgttctcttttttaatgatgtgtggagcaaacaattttggaaggaaattgaacatatcattggtcataac |
243 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22198959 |
aaaacggtatgttctcttctttaatgatgtgtggaaaaaacaattttggaaggaaattgaacatatcattggtcataac |
22199037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 22196027 - 22195985
Alignment:
| Q |
1 |
tctcgttgtcgtaaatttgcttgacaagagtggtttttccctg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22196027 |
tctcgttgtcgtaaatttgcttgacaagagtggtttttccctg |
22195985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 22198784 - 22198742
Alignment:
| Q |
1 |
tctcgttgtcgtaaatttgcttgacaagagtggtttttccctg |
43 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22198784 |
tctcgttgtcataaatttgcttgacaagagtggtttttccctg |
22198742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University