View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_low_39 (Length: 238)
Name: NF9115_2D_low_39
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 53247433 - 53247649
Alignment:
| Q |
5 |
agcatgttgctgattggggatgctagcctgggtatactgccacaaatatggaacaaaccttttttactatgatgcaaaataacaaaagctgatacttttt |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53247433 |
agcatgttgctgactggggatgctagcctgggtatactgccacaaatatggaacaaaccttttttactatgatgcaaaataacaaaagctgatacttttt |
53247532 |
T |
 |
| Q |
105 |
attttgaaatgctcatcgtctgatgttttatggtgtttggcctaggcaaattagttctctataatgacaccacaaaataaactgcttatagattggtgtt |
204 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
53247533 |
atttttaaatgctcttcgtccgatgttttatggtgtttggcctaggcaaattagttctctataatgacaccacaatttaaactgcttataaattggtgtt |
53247632 |
T |
 |
| Q |
205 |
tcttttaggattgatat |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53247633 |
tcttttaggattgatat |
53247649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 59 - 221
Target Start/End: Complemental strand, 53255085 - 53254923
Alignment:
| Q |
59 |
aaaccttttttactatgatgcaaaataacaaaagctgatactttttattttgaaatgctcatcgtctgatgttttatggtgtttggcctaggcaaattag |
158 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53255085 |
aaacctgttttactatgattccaaataacaaaagctgatacttttcattttgaaatgctcttcgtcttatgttttatggtgtttggcctaggcaaattag |
53254986 |
T |
 |
| Q |
159 |
ttctctataatgacaccacaaaataaactgcttatagattggtgtttcttttaggattgatat |
221 |
Q |
| |
|
|||| ||| |||||| || ||||||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
53254985 |
ttctttatgatgacagcataaaataaactgctattaaattggtgtttcttttaagattgatat |
53254923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University