View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_low_40 (Length: 235)
Name: NF9115_2D_low_40
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_low_40 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 1374571 - 1374786
Alignment:
| Q |
20 |
atgaggttattaggcaaacttttactattgcattccaaaaagtctcaaagccattcgtggtctgaaaatcatcttcagacgctaaatatcaggcctctta |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1374571 |
atgaggttattaggcaaacttttaccattgcattccaaaaagtctcaaagccattcgtggtctgaaaatcatcttcagacgctaaatatcaggcctctta |
1374670 |
T |
|
| Q |
120 |
ccttctactgtttgcaatggcttacataccttcagtatgattcccatttacttttcattttccaatctttattataccgttgatggccggtctgctcact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1374671 |
ccttctactgtttgcaatggcttacataccttcagtatgattcccatttacttttcattttccaatctttattataccgttgatggccggtctgctcact |
1374770 |
T |
|
| Q |
220 |
acatcgcatccaattc |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1374771 |
acatcgcatccaattc |
1374786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University