View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9115_2D_low_50 (Length: 214)

Name: NF9115_2D_low_50
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9115_2D_low_50
NF9115_2D_low_50
[»] chr4 (1 HSPs)
chr4 (45-193)||(55076966-55077114)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 45 - 193
Target Start/End: Original strand, 55076966 - 55077114
Alignment:
45 acaatagtcaatgttgataatttataggatgacgtcggctgcttcggggagttgttaagtgcttttagtggattaaagaaaccaatgtggatgctaatga 144  Q
    ||||| |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076966 acaattgtcaatgtttgtaatttataggatgacgtcggctgcttcggggagttgttaagtgcttttagtggattaaagaaaccaatgtggatgctaatga 55077065  T
145 tagtaaccgctataaattgggtagcatggttcccatttttcttgttcga 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
55077066 tagtaaccgctataaattgggtagcatggttcccatttttcttgttcga 55077114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University