View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_low_51 (Length: 214)
Name: NF9115_2D_low_51
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 45 - 193
Target Start/End: Original strand, 55076966 - 55077114
Alignment:
| Q |
45 |
acaatagtcaatgttgataatttataggatgacgtcggctgcttcggggagttgttaagtgcttttagtggattaaagaaaccaatgtggatgctaatga |
144 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076966 |
acaattgtcaatgtttgtaatttataggatgacgtcggctgcttcggggagttgttaagtgcttttagtggattaaagaaaccaatgtggatgctaatga |
55077065 |
T |
 |
| Q |
145 |
tagtaaccgctataaattgggtagcatggttcccatttttcttgttcga |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55077066 |
tagtaaccgctataaattgggtagcatggttcccatttttcttgttcga |
55077114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University