View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_2D_low_54 (Length: 208)
Name: NF9115_2D_low_54
Description: NF9115_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_2D_low_54 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 18269935 - 18270130
Alignment:
| Q |
13 |
ggacatcaacctaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgaatcatggtggctagaagcgataaaagtag |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18269935 |
ggacatcaaccgaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgattcatggtggctagaagcgataaaagtag |
18270034 |
T |
 |
| Q |
113 |
ttgaggaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaatag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270035 |
ttgaggaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaatag |
18270130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University