View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_low_22 (Length: 334)
Name: NF9115_low_22
Description: NF9115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 27 - 317
Target Start/End: Complemental strand, 35479314 - 35479020
Alignment:
| Q |
27 |
ataatataaagtggaagacattgttttggttttagctattttttgggtgacatggtttcatccaccagtactgcaaannnnnnnnnnnngaagtaagacg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35479314 |
ataatataaagtggaagacattgttttggttttagctattttttgggtgacatggtttcatccaccagtactgcaaattttttatttttgaagtaagacg |
35479215 |
T |
 |
| Q |
127 |
tgtgcacgcaatgcagcattatctgctcgtacaattcatataaattatagttttgctgtcatgtggtagctatcaaatgcttgtttaatggatggtatga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35479214 |
tgtgcacgcaatgcagcattatctgctcgtacaattcatataaattatagttttgctgtcatgtggtagctatcaaatgcttgttcaatggatggtatga |
35479115 |
T |
 |
| Q |
227 |
ggttgttatctttgatgttcggtttgc----ttagctttcttcgatgtggtgctttgtttatctttgatgtttttaggagttaagtagaactttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35479114 |
ggttgttatctttgatgttcggtttgcttaattagctttcttcgatgtggtgctttgtttatctttgatgtttttaggagttaagtagaactttt |
35479020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University