View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9115_low_27 (Length: 254)
Name: NF9115_low_27
Description: NF9115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9115_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45914218 - 45913994
Alignment:
| Q |
1 |
ttgaagcaatctggaccgtgtgatgaatcaggcggttgaaatgtagagaatccggatccatagtacaacataacataggatcgaatgatttaagtaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45914218 |
ttgaagcaatctggaccgtgtgatgaatgagacggttgaaatgaagagaatccggatccgtagtacaacataacataggatcgaatga------------ |
45914131 |
T |
 |
| Q |
101 |
gtgagtatagcgaagcagaaggtagattggaaaatctgttgtaccgacatttgagtatgagttttggcggtgttctatggatatctatgactatatgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45914130 |
----gtatagcgaagcagaaggtagattggaaaatctgttgtaccgacatttgagtatgagttttggcggtgttctatggatatctatgactatatgcat |
45914035 |
T |
 |
| Q |
201 |
cttcttctcttccgtttctttagctttgagtgtgagtagtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45914034 |
cttcttctcttccgtttctttagctttgagtgtgagtagtg |
45913994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University